[PDF] Top 20 Desarrollo de una solución de inteligencia de negocios para apoyar el proceso de toma de decisiones en la dependencia de recursos educativos de la Universidad Del Magdalena

... may be due to the influence of data collection with interview which based on memory and differences in respondent’s perception. Other influencing factor is this study did not take into account about the individual ... See full document

... cancer risk in Korean men and women and found for both sexes the average baseline BMI was ...of risk for all cancer with BMI was ...increased risk for developing the following cancers: Stomach, ... See full document

... the prevalence of pterygium and its relationship with the prevalence of age-re- lated cataract (ARC) among rural populations age 50 years or older in two different latitude areas in ... See full document

... causative factors like obesity, change in dietary habits, decreased physical activity and increasing stress early in ...The prevalence of hypertension among children reported by various studies ranges from ... See full document

... (seven coronary embolisms, four spontaneous dissections, and two arteritis), and 413 patients were excluded due to the lack of a complete lipid profile at the time of admission (Figure 1). We thus analyzed 3,447 patients ... See full document

... the above studies were all invited from western medical hospitals, while participants of our study were from traditional Chinese medical hospital, which may explain the differences in ...lower prevalence of ... See full document

... An overall prevalence and specific population prevalence of microalbuminuria were estimated along with their 95% confidence interval (CI). Categorical variables were summarized using frequency and ... See full document

... 19-years old between January 1, 2008, through December 31, 2013, and received an ophthalmologic or optometric ...data. Prevalence and relative risks of myopia (defined as ... See full document

... higher risk of DM in the antiretroviral- naive HIV infected population who were <50 years old, while no increased risk was found in the Swiss HIV cohort study or an urban ... See full document

... cardiometabolic risk factors in obese adolescents may increase the engagement of adolescents and their families with efforts to treat ...the prevalence of cardiometabolic risk factors ... See full document

... A total of 1483 women were identified as meeting the inclusion criteria in the absence of any exclusion criteria. Each was evaluated with a full physical exam and had their anthropomorphic measurements such as weight, ... See full document

... HE3: 5' TATAGGTACCGTCATTATCTTCCCTAT 3' Two rounds of PCR in a final volume of 25 µl were carried out in a PCR thermal cycler (Applied Biosystems, USA). In the primary PCR assay for amplification of all canine ehrlichial ... See full document

... Chronic in fl ammation is common in hemodialysis patients and may play an important role in the development of cardi- ovascular diseases. In the current study, the logistic regression analysis showed that hs-CRP was ... See full document

... association with their counterparts. The major significant correlates of depression were unplanned pregnancy, lack of family support, and mothers as housewives, whereas for anxiety disorders, lack of family support and ... See full document

... Ethical approval was obtained from the Jimma University Eth- ics Review Board. Written informed consent was obtained from participants after a comprehensive explanation of the purpose and procedure of the study in local ... See full document

... middle prevalence value of GDM in the Arabian Peninsula (10%) with a 95% confidence level and a ± ...the prevalence of GDM, the methods of FBG and RBG were used for diagnosing the blood samples according to ... See full document

... between 50 and 80 years ...Participants above the age of 80 will be excluded from the study, as the five-year survival rate for patients with gastric cancer above the age of 80 is only 8% thus ... See full document

... 1 Population-based stu- dies have reported prevalence of retinal disorders ranging from ...40 years and ...In population- and hospital-based studies, AMD, hypertensive retinopa- thy, DR, and ... See full document

... frequent occurrence in nephroangiosclerosis, focal glomeruloscle- rosis and cholesterol emboli, conditions found in ischem- ic nephropathy [25–27] among the ... See full document

... Figure 1: Representative images in coronal plane of T1WI (TE = 11 msec, TR = 440 msec) of a 63 years old male subject showing the manual tracing of left hippocampus. (a) No clear boundary identified as ... See full document