[PDF] Top 20 O lúdico na concepção e prática dos professores de uma escola pública em Carinhanha-BA
Has 10000 "O lúdico na concepção e prática dos professores de uma escola pública em Carinhanha-BA" found on our website. Below are the top 20 most common "O lúdico na concepção e prática dos professores de uma escola pública em Carinhanha-BA".
Virulence genes and antibiotic resistance of Yersinia enterocolitica strains isolated from children
... (28.6%) strains were resistant to amikacin and gentamicin, ...the strains were sensitive to ...resistant strains were found ...four strains (19%) were resistant to this sulfonamide. Sporadic ... See full document
26
Antibiotic resistance pattern and molecular characterization of extended-spectrum β-lactamase producing enteroaggregative <em>Escherichia coli</em> isolates in children from southwest Iran
... highest resistance rate to ampicillin (100%) and co-trimoxazole (100%), followed by ceftriaxone ...CTX-M genes, respectively, and 17 ...with virulence genes highlights a need to restrict ... See full document
8
Virulence Determinants and Antimicrobial Resistance Patterns of Vancomycin-resistant Enterococcus faecium Isolated from Different Sources in Southwest Iran
... with antibiotic resistance, have been regarded as important determinants of the bacterial colonization, establishment, and persistence of vancomycin-resistant enterococci (VRE) in hospital settings ... See full document
18
Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran
... terial virulence factors are able to causes severe diarrhea in calves ...another virulence factors including phage-encoded cytotoxins, called Shiga toxin 1 ( stx1 ) and Shiga toxin 2 ( stx2 ), the protein ... See full document
9
Genotyping and distribution of putative virulence factors and antibiotic resistance genes of Acinetobacter baumannii strains isolated from raw meat
... certain virulence factors in the A. baumannii strains isolated from meat of different ...detected virulence genes amongst these A. baumannii strains were fimH, afa/draBC, ... See full document
67
Antibiotic resistance, serogroups, virulence genes, and phylogenetic groups of Escherichia coli isolated from yaks with diarrhea in Qinghai Plateau, China
... coli strains were allocated to phylogenetic groups, A, B1, B2, C, D, E, and F as previously suggested ...analysis, antibiotic-resist- ant ...low virulence traits [12, ...extraintestinal ... See full document
25
A study of virulence and antimicrobial resistance pattern in diarrhoeagenic Escherichia coli isolated from diarrhoeal stool specimens from children and adults in a tertiary hospital, Puducherry, India
... sulphonamide resistance genes are wide- spread being plasmid-borne, harbored by the bacteria inhabiting the aquatic bodies and in ...These resistance genes are capable of circulating among the ... See full document
14
Helicobacter pylori in children: Molecular characterization, antibiotic resistance and MLST typing of isolated strains in an Algerian hospital
... In children, the prevalence rate of ...the virulence factors and the geographical origin of the strains are among the factors most influencing the evolution towards the most severe pathologies ... See full document
6
Biofilm formation, antimicrobial susceptibility, serogroups and virulence genes of uropathogenic E. coli isolated from clinical samples in Iran
... coli strains. Biofilm formation is closely related with the resistance of ...drug resistance in UPEC. Antibiotic re- sistance may provide a substantial advantage to the sur- vival of the ... See full document
64
Study of the frequency of Clostridium difficile tcdA, tcdB, cdtA and cdtB genes in feces of Calves in south west of Iran
... of antibiotic-associated diar- rhea ...Pathogenic strains in humans and animals especially calves, are very similar ...of antibiotic resistance in ...and virulence genes, and ... See full document
147
The virulence phenotypes and molecular epidemiological characteristics of Vibrio fluvialis in China
... the antibiotic resistant conditions of our V. fluvialis strains were not as serious as those reported in the literatures where the SXT element, plasmid and integrons mediated MDRs were quite common in ... See full document
6
Diagnostics and antibiotic resistance of Yersinia Ruckeri strains isolated from trout fish farms in Bulgaria
... of Yersinia species and preliminary differentiation of Y. enterocolitica from human and animal intestinal contents (Wauters, ...of Yersinia species from foods (International ... See full document
22
Antibiotic Resistance, Virulence Gene, and Molecular Profiles of Shiga Toxin Producing Escherichia coli Isolates from Diverse Sources in Calcutta, India
... The standardization of the RAPD-PCR and PFGE methods and computer-based submission of the genomic profiles enable discriminative and rapid comparison of STEC strains among laboratories. In the United States, a ... See full document
146
Whole-genome comparative analysis of Campylobacter jejuni strains isolated from patients with diarrhea in northeastern Poland
... antimicrobial resistance patterns identified in our ...ST257 strains, i.e. resistance to fluoroquinolones only or fluoroquinolones and tetracy- clines, in general are consistent with the patterns ... See full document
36
<p>Antimicrobial Resistance of <em>Staphylococcus aureus</em> Isolated from Hospital Wastewater in Kermanshah, Iran</p>
... sewage treatment plant of Imam Reza Hospital, as the largest general and referral center in the west of Iran. With a few days interval between sampling, it was tried to cover any fluctuation in the bacterial load of the ... See full document
80
Niefnecker, Julia (2009): Identifizierung von virulenzassoziierten Antigenen bei enteropathogenen Yersinien und Campylobacter jejuni. Dissertation, LMU München: Medizinische Fakultät
... (1985) Genetic analysis of virulence plasmid from a serogroup 9 Yersinia enterocolitica strain: role of outer membrane protein P1 in resistance to human serum and autoagglutination.. ([r] ... See full document
6
Comparative genomic approaches to understanding Achromobacter xylosoxidans
... dehydrogenase genes between Neisseria meningitidis and other Neisseria species affects phylogenetic structure (Zhou, Bowler & Spratt, ...biosynthesis genes and drug resistance genes ... See full document
28
<p>Molecular Characteristics, Antimicrobial Resistance and Virulence Gene Profiles of <em>Staphylococcus aureus</em> Isolates from Wuhan, Central China</p>
... differs from other areas in ...The genes pvl, sea, seb, sec, sed, see, seg, seh and sei were detected at respective frequencies of ...isolates from Wuhan, leading us to conclude that S. aureus ... See full document
6
A Study of Virulence Factors Associated with ESβL Producing Escherichia Coli Isolates from Patients with Urinary Tract Infection at A Nigerian Tertiary Hospital
... i. Reverse sequence- CTGACAGTTACCAATGCTTA [16] A small amount of culture of each isolate was taken from nutrient aga plate using a sterile culti-loop and inoculated into an Eppendorf tube containing sterile ... See full document
137
ORIGINALRESEARCH Diversity of Virulence Genes in Multidrug Resistant Escherichia coli from a Hospital in Western China
... coli strains harbor a high rate of virulence genes in addition to high antimicrobial resistance (Table ...of virulence genes and that their virulence gene pro fi les are ... See full document
7
Related subjects